View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16673_high_5 (Length: 296)
Name: NF16673_high_5
Description: NF16673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16673_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 5e-90; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 100 - 287
Target Start/End: Complemental strand, 41787602 - 41787416
Alignment:
| Q |
100 |
caacttttctggataattgttaattgcaatcatagttttgttcacattgctaaatccattggattttcacataaaaaaggatgaaaaatgaagacagagt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41787602 |
caacttttctggataattgttaattgcaatcatagttttgttcacattgctaaatccattggattttcacataaaaaaggatgaaaaatgaagacagagt |
41787503 |
T |
 |
| Q |
200 |
taacggtagttgcctgcacattaggtttgcaaataatgggtgcatgcatacccttaaagggtacaatcgtttccctacatatattctt |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41787502 |
taacggtagttgcctgcacattaggtttgcgaa-aatgggtgcatgcatacctttaaagggtacaatcgtttccctacatatgttctt |
41787416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 41787830 - 41787733
Alignment:
| Q |
1 |
ttagtggaggagcaggatagatcaaatgagctcacaagtatattcagtacattgctattttttctctttccttgccttagtcgtaagatatgcaaccc |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41787830 |
ttagtggaggagcaggatagatcaaatgagctcacaagtatattcagtacattgctattttttctctttccttgccttagtcgtaagatatgcaaccc |
41787733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University