View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16674_low_6 (Length: 244)
Name: NF16674_low_6
Description: NF16674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16674_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 49302341 - 49302116
Alignment:
| Q |
1 |
tctgcataaattgattccacaattcttgggctagccacttcaaaaccacttggacaaagacagaacttggagcttagcattatggaatagtagtctatgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49302341 |
tctgcataaattgattccacaattcttgggctagccacttcaaaaccacttggacaaagacagaacttggagcttagcattatggaatagtagtctatgc |
49302242 |
T |
|
| Q |
101 |
ctttagggagatactcattgacaagaatatctttgtctctgtttttccagtgttggagaagaattgggcgaattgggccatgcataccacctgcaaagaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49302241 |
ctttagggagatactcattgacaagaatatctttgtctctgtttttccagtgttggagaagaattgggcgaattgggccatgcataccacctgcaaagaa |
49302142 |
T |
|
| Q |
201 |
ggcaagataccggcgtggggcgttct |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
49302141 |
ggcaagataccggcgtggggcgttct |
49302116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 56
Target Start/End: Original strand, 47727958 - 47728010
Alignment:
| Q |
4 |
gcataaattgattccacaattcttgggctagccacttcaaaaccacttggaca |
56 |
Q |
| |
|
|||| ||||| ||||||||||||||| |||||||||||| | ||||||||||| |
|
|
| T |
47727958 |
gcattaattgcttccacaattcttggactagccacttcatatccacttggaca |
47728010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University