View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16675_high_14 (Length: 254)
Name: NF16675_high_14
Description: NF16675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16675_high_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 62 - 199
Target Start/End: Complemental strand, 26834914 - 26834777
Alignment:
| Q |
62 |
catccttaaccaattttatactcaacactccatcatgcattgaagccttgacatcatcaacttttgcattctcaggtaacctaaattctttcatgaacac |
161 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
26834914 |
catccttaaccaattttatagtcaacactccatcatgcattgaagccttgacatcatcaacttttgcattctccggtaacctaaattccttcatgaacac |
26834815 |
T |
|
| Q |
162 |
accattgttccttctctccttgcaatgccacttgagac |
199 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26834814 |
accattgttctttctctccttgcaatgccacttgagac |
26834777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University