View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16675_high_16 (Length: 239)
Name: NF16675_high_16
Description: NF16675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16675_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 28 - 197
Target Start/End: Original strand, 42946768 - 42946937
Alignment:
| Q |
28 |
attcacaaggtgatcatttatttgtcttgctaatgtgataggggttttgatttggaaaataataaatatgcctacttaactatgaattaaatatgagatt |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42946768 |
attcacaaggtgatcatttatttgtcttgctaatgtgataggggttttgatttggaaaataataaatatgcctacttaactatgaattaaatatgagatt |
42946867 |
T |
 |
| Q |
128 |
ttgaagatcttgtctttaatgacaaatacaagtaggagctcagctcatatgacagcagagcaagactaaa |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42946868 |
ttgaagatcttgtctttaatgacaaatacaagtaggagctcagctcatatgacagcagagcaagactaaa |
42946937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University