View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16675_low_14 (Length: 321)
Name: NF16675_low_14
Description: NF16675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16675_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 17 - 290
Target Start/End: Complemental strand, 40669608 - 40669330
Alignment:
| Q |
17 |
acttacatttccattagtcgccgatgtggcagtggaggaggcacatgaatgttttcagttttgtggcagagacggagggagtcggagaggtgaggaatca |
116 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40669608 |
acttacatttccattagacgtcgatgtggcagtggaggaggcacatgaatgttttccgttttgtggcagagacggagggagtcggagaggtgaggaatca |
40669509 |
T |
 |
| Q |
117 |
cacggtgtagatccaactcggcggcgtgaagaagatcatggtaagggatagtgatcgtagaaattcgtttgatcagttagagatttgtggagatttcagt |
216 |
Q |
| |
|
||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40669508 |
cacagtgtagatccaacccggcggcgtgaagaagatcatggtaagggatagtgatcgtaggaattcgtttgatcagttagagatttgtggagatttcagt |
40669409 |
T |
 |
| Q |
217 |
tgtcggattcaacgttg-----gtggagcttgctagcgcggtgtttgttgatggagaaatgactgttacggtggtgatg |
290 |
Q |
| |
|
|| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40669408 |
tgccggattcaacgttgctggcatggagcttgctagcgcggtgtttgttgatggagaaatgactcttacggtggtgatg |
40669330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 17 - 320
Target Start/End: Original strand, 17056243 - 17056531
Alignment:
| Q |
17 |
acttacatttccattagtcgccgatgtggcagtggaggaggcacatgaatgttttcagttttgtggcagagacggagggagtcggagaggtgaggaatca |
116 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
17056243 |
acttacatttccattagacgccgatgtggcagtggaggaggcacatgaatgttttccgttttgtggcagagacagagggagtcggagaggtgaggaatca |
17056342 |
T |
 |
| Q |
117 |
cacggtgtagatccaactcggcggcgtgaagaagatcatggtaagggatagtgatcgtagaaattcgtttgatcagttagagatttgtggagatttcagt |
216 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
17056343 |
cacggtgtagatccaacccggcggcgtgacgaagatcatggtaagggatagtgatcgtaggaattcgtttgatcagttagagatttgtggagatatcagt |
17056442 |
T |
 |
| Q |
217 |
tgtcggattcaacgttggtggagcttgctagcgcggtgtttgttgatggagaaatgactgttacggtggtgatggttatcggtgatgatagagttgaaat |
316 |
Q |
| |
|
|| | |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
17056443 |
tgcc---------------ggagcttgctagtgcggtgtttgttgatggagaaatgactgttacggtggtgatggttattggtgatgatagagttgaaat |
17056527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University