View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16675_low_18 (Length: 253)
Name: NF16675_low_18
Description: NF16675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16675_low_18 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 13 - 253
Target Start/End: Original strand, 35296377 - 35296617
Alignment:
| Q |
13 |
gagaagaaaatggttgtgcagatttacttgcgtctcatgggcattcgacatcattctctttaactgttattgatagtttcttccctttattagatgctat |
112 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35296377 |
gagaagaaaatggttgtgcatatttacttgcgtctcatgggcattcgacatcattctctttaactgttattgatagttccttccctttattagatgctat |
35296476 |
T |
 |
| Q |
113 |
tatgttaaatactctgataactgtgttatggatgttgcaactatatattgtaatccaatatttatttgatgccatgttttggtttaaaactctcaactat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |||||||||||||| |||||| |||| |||| |
|
|
| T |
35296477 |
tatgttaaatactctgataactgtgttatggatgttacaactatatattgtaatgcaatatttatttggtgccatgttttggtctaaaaccctcagctat |
35296576 |
T |
 |
| Q |
213 |
gaaggataggtactcgacttttgatggacgtcaatacttct |
253 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||| |||| |
|
|
| T |
35296577 |
gaaggataggtacttgacttttgatggacgacaataattct |
35296617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University