View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16675_low_20 (Length: 235)
Name: NF16675_low_20
Description: NF16675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16675_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 15 - 216
Target Start/End: Original strand, 23430860 - 23431063
Alignment:
| Q |
15 |
atgaagatgcaatgttaagtgttcattttcttggattgtttgtttatatgggatggatccaaagaaaactattaaatcaggggctgttaaattatcataa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
23430860 |
atgaagatgcaatgttaagtgttcattttcttggattgtttgtttatatgggatggctccaaagaaaactattaaatcaggggttgttaaattatcataa |
23430959 |
T |
|
| Q |
115 |
cacccatttaaatttttaactatattaaccatttctttactgacttatttctaa--actcaattaggggctggaaaacatacatatatgatgggagtata |
212 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23430960 |
cacccatttaagtttttaactatattaactatttctttactgacttatttctaaacactcaattaggggctggaaaacatacatatatgatgggagtata |
23431059 |
T |
|
| Q |
213 |
aacc |
216 |
Q |
| |
|
|||| |
|
|
| T |
23431060 |
aacc |
23431063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University