View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16675_low_21 (Length: 203)
Name: NF16675_low_21
Description: NF16675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16675_low_21 |
 |  |
|
| [»] scaffold0044 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0044 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: scaffold0044
Description:
Target: scaffold0044; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 14 - 186
Target Start/End: Complemental strand, 92027 - 91851
Alignment:
| Q |
14 |
atgaagaaggaccattagcaagcgagttttgaagaaccaaacacaagcatatcccaaatcatgagataccacaatcggaaagatgaaatgaccgagtagt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
92027 |
atgaagaaggaccattagcaagcgagttttgaagaaccaaacacaagcacaacccaaatcatgagataccacaatcggaaagatgaaatgaccgagtagg |
91928 |
T |
 |
| Q |
114 |
tgccggagatttacagaccttttcgagtta----tgcgaccacggttaatgcttcatggttgtgcaatggtgatatt |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
91927 |
tgccggagatttacagaccttttcgagttatgcgtgcgaccacggttaatgcttcatggttgtgcaatggtgatatt |
91851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University