View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16676_high_29 (Length: 280)
Name: NF16676_high_29
Description: NF16676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16676_high_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 18 - 271
Target Start/End: Original strand, 31174897 - 31175150
Alignment:
| Q |
18 |
ctaaatggaagggttgtataatagtttgaagcatatgcatatgcatagtatagaagtaccagatggattcttgaaagcatatgcatcttttgcagtgagc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31174897 |
ctaaatggaagggttgtataatagtttgaagcatatgcatatgcatagtatagaagtgccagatggattcttgaaagcatatgcatcttttgcagtgagc |
31174996 |
T |
|
| Q |
118 |
aagccatcaaatgaagatgtccagttgatagtgtcttctgttagattcaaatggttggagtcttcatgatggttgcaacttcttagggtaatttctcaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31174997 |
aagccatcaaatgaagatgtccagttgatagtgtcttctgttagattcaaatggttggagtcttcacgatggttgcaacttcttagggtaatttctcaaa |
31175096 |
T |
|
| Q |
218 |
gaagtaatttaggatattcgattggccattcaaactataacctgaaaccttcat |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31175097 |
gaagtaatttaggatattcgattggccattcaaactataacctgaaaccttcat |
31175150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University