View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16676_low_16 (Length: 425)
Name: NF16676_low_16
Description: NF16676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16676_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 389; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 389; E-Value: 0
Query Start/End: Original strand, 1 - 409
Target Start/End: Original strand, 936161 - 936569
Alignment:
| Q |
1 |
agtagaatgcaaaaagagaaagcttcctcatggggtgaagccgtgaaggcaaagccgtttatggggcttttagcaatgcttttgacacaagttacacaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
936161 |
agtagaatgcaaaaagagaaagcttcctcatggggtgaagccgtgaaggcaaagccgtttatggggcttttagcaatgcttttgacacaagttacagaat |
936260 |
T |
 |
| Q |
101 |
ttttgtttatgtgcgtatttgaattttttaacatccaggaatcactcactcggaaagaatgaagcctgggatgctaaatttgatgctatacatataatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
936261 |
ttttgtttatgtgcgtatttgaatttcttaacatccaggaatcactcactcggaaagcatgaagcctgggatgctaaatttgatgctatacatataatga |
936360 |
T |
 |
| Q |
201 |
ttgacgaggagggtttagatacacaaacatatgaggatatctattttaaggttatggggaagtgtatttcaaatcgtgagaatagtactaatgaggaaga |
300 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
936361 |
ttgacaaggagggtttagatacacaaacatatgaggatatctattttaaggttatggggaagtgtatttcaaatcgtgagaatagtactaatgaggaaga |
936460 |
T |
 |
| Q |
301 |
agaagaatgcaagggttgagagaaagaaaaagaggagcagttactgaagaacatgtatataagcaagggttgcataatccagctgtttgcctttttgttc |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
936461 |
agaagaatgcaagggttgagagaaagaaaaagaagagcagttactgaagaacatgtatataagcaagggttgcataatccagctgtttgcctttttgttc |
936560 |
T |
 |
| Q |
401 |
tcttgtttt |
409 |
Q |
| |
|
||||||||| |
|
|
| T |
936561 |
tcttgtttt |
936569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University