View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16676_low_23 (Length: 345)
Name: NF16676_low_23
Description: NF16676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16676_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 39490512 - 39490265
Alignment:
| Q |
1 |
tttaatttaaatatgttgttattggcgatttgaagtgtatatttgatattacgaagttggacaaaattatagtatcatggtgagttcataatttgtaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39490512 |
tttaatttaaatatgttgttattggcgatttgaagtgtatgtttgatattacgaagttggacaaaattatagtatcatggtgagttcataatttgtaact |
39490413 |
T |
|
| Q |
101 |
tttgcaagaataggatgcttccccataattttgtaaaacacattgcgatatcaaataagtactagattgtgtcttttggttttgaggttgatctcgcttg |
200 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39490412 |
tttgcaagaataggatgtttcaccataattttgtaaaacacattgcgatatcaaataagtactagattgtgtcttttggttttgaggttgatctcgcttg |
39490313 |
T |
|
| Q |
201 |
tacatctccgtctccatttgtttttaattttagaaaggaaaaataact |
248 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39490312 |
tacatctcggtctccatttgtttttaattttagaaaggaaaaataact |
39490265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University