View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16676_low_24 (Length: 331)
Name: NF16676_low_24
Description: NF16676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16676_low_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 253; Significance: 1e-140; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 41 - 297
Target Start/End: Complemental strand, 19476952 - 19476696
Alignment:
| Q |
41 |
gccatcttactcttgttcttctttgcttattttcatcattattttcttctacgaaataagtacactataaacttttttacttatacttcttctatataca |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19476952 |
gccatcttactcttgttcttctttgcttattttcatcattattttcttctaggaaataagtacactataaacttttttacttatacttcttctatataca |
19476853 |
T |
 |
| Q |
141 |
gtgtaatcattgtagccgtgtaagcagtgtttaatcttttgaaaccttttgtgtcttgttggcacagcaaaatattgacatcgacccaattggatcattt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19476852 |
gtgtaatcattgtagccgtgtaagcagtgtttaatcttttgaaaccttttgtgtcttgttggcacagcaaaatattgacatcgacccaattggatcattt |
19476753 |
T |
 |
| Q |
241 |
ccttctcctcatactctcatttttaagcaagttgtgtatatctctctattgatcata |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19476752 |
ccttctcctcatactctcatttttaagcaagttgtgtatatctctctattgatcata |
19476696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University