View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16676_low_29 (Length: 293)
Name: NF16676_low_29
Description: NF16676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16676_low_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 6e-71; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 74 - 233
Target Start/End: Complemental strand, 37307098 - 37306936
Alignment:
| Q |
74 |
ttatatatgtaatttttt-cctcaaataccaatataa--tactagtataattagagtatatttacattatcgtagagtacgtgaatgaatataagtaaat |
170 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37307098 |
ttatatatgtaatttttttcctcaaataccaatatatactactagtataagtagagtatatttacattatcgtagagtacgtgaatgaatataagtaaat |
37306999 |
T |
|
| Q |
171 |
tcagtagggaagagtaaaaattaacgagtttggtagccgtcatcttttgcaccatctactctc |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37306998 |
tcagtagggaagagtaaaaattaacgagtttggtagccgtcatcttttgcaccatctactctc |
37306936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 16 - 50
Target Start/End: Original strand, 6599212 - 6599246
Alignment:
| Q |
16 |
tgcatgcctaagaatgttcgattagctttttagtt |
50 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
6599212 |
tgcatgcctaagaatgttcgtttagctttttagtt |
6599246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 16 - 50
Target Start/End: Complemental strand, 7305023 - 7304989
Alignment:
| Q |
16 |
tgcatgcctaagaatgttcgattagctttttagtt |
50 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |
|
|
| T |
7305023 |
tgcatgcctaagaatgttcgattagcttcttagtt |
7304989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 16 - 53
Target Start/End: Complemental strand, 37307200 - 37307163
Alignment:
| Q |
16 |
tgcatgcctaagaatgttcgattagctttttagttcta |
53 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
37307200 |
tgcatgcctaggaatcttcgattagctttttagttcta |
37307163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University