View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16676_low_32 (Length: 287)
Name: NF16676_low_32
Description: NF16676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16676_low_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 7e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 31175151 - 31175367
Alignment:
| Q |
1 |
atccaactgcttgtgaatattagctggaatgtgaagcaaatcagctaaaggaggatcaagtcatttatctgtctaaaaagcaatat-ttggccattgccg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31175151 |
atccaactgcttgtgaatattagctggaatgtgaagcaaatcagctaaaggaggatcaagtcatttatctgtctaaaaagcaatatcttggccattgccg |
31175250 |
T |
 |
| Q |
100 |
attgnnnnnnnnncttagtctcactttggttagtttacgcatattgtatagctttctacgatagaaagagtgttaaatcttttgagaaaaacacatcaaa |
199 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31175251 |
attg-aaaaaaaacttagtctcactttggttagtttacgcatattgtatagctttcaacgatagaaagagtgttaaaccttttgagaaaaacacatcaat |
31175349 |
T |
 |
| Q |
200 |
tcttgacggcctaccaag |
217 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
31175350 |
tcttgacggcctaccaag |
31175367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University