View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16676_low_33 (Length: 281)
Name: NF16676_low_33
Description: NF16676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16676_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 9 - 265
Target Start/End: Complemental strand, 2601643 - 2601382
Alignment:
| Q |
9 |
gaaaagaaattgcaaagagatgcatagattggggtacggagcaccattcacggggtgggatgttgaaaaattgggggagggggtactaaacatgattaag |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2601643 |
gaaaagaaattgcaaagagatgcatagattgtggtacggagcaccattcatggggtgggatgttgaaaaattgggggagggggtactaaacatgattaag |
2601544 |
T |
 |
| Q |
109 |
gaggtgtgggaatgaaaaacaatggaagaggagaaggtttgatatatgacggtgcaccaatttttctactaa----cattgtcctcgtcactttctctga |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2601543 |
gaggtgtgggaatgaaaaacaatggaagaggagaaggtttgatatatgacagtgcaccaatttttctactaacatgcattgtcctcgtcactttctctga |
2601444 |
T |
 |
| Q |
205 |
tgtctctcctctccattgttggcgtgttcattgattcatcaccactc-tttgatgttgttga |
265 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2601443 |
tgtctctcctctctgttgttggtgtgttcattgattcatcaccactcttttgatgttgttga |
2601382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University