View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16676_low_42 (Length: 242)
Name: NF16676_low_42
Description: NF16676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16676_low_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 12 - 228
Target Start/End: Original strand, 46410048 - 46410268
Alignment:
| Q |
12 |
atactggtttcatcccctccaagtttgtctccaaaataggcaatactattagcatccgtgcactgaagaagaatgcaggagcactagattttcttggcgg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46410048 |
atactggtttcatcccctccaagtttgtctccaaaataggcaatactattagcaaccgtgcactgaagaagaatgtaggagcactagattttcttggcgg |
46410147 |
T |
 |
| Q |
112 |
taattcgaaacaaaatattattttactaataactttcattccat----tacataaatgcccagcaaaagcaaaagagagggacacaatagtggtgtgatg |
207 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46410148 |
taattcgaaacaaaatattattttactcataactttcattccattacgtacataaatgcccagcaaaagcaaaagagagggacacaatagtggtgtgatg |
46410247 |
T |
 |
| Q |
208 |
gaggttcgtcattacgatgtg |
228 |
Q |
| |
|
||||||||| | ||||||||| |
|
|
| T |
46410248 |
gaggttcgttaatacgatgtg |
46410268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University