View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16676_low_48 (Length: 213)
Name: NF16676_low_48
Description: NF16676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16676_low_48 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 58; Significance: 1e-24; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 134 - 195
Target Start/End: Complemental strand, 9418179 - 9418118
Alignment:
| Q |
134 |
ttaaattgaaagaaaaaacttgttttattttgttacaaagacttgaacaaacacatcacatt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9418179 |
ttaaattgaaagaaaaaacttgttttattttgttacaaagacttgaagaaacacatcacatt |
9418118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 89 - 122
Target Start/End: Complemental strand, 9418210 - 9418177
Alignment:
| Q |
89 |
tgcacttgaagctaacatttcatggacaaactta |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
9418210 |
tgcacttgaagctaacatttcatggacaaactta |
9418177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University