View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16678_high_41 (Length: 212)

Name: NF16678_high_41
Description: NF16678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16678_high_41
NF16678_high_41
[»] chr7 (1 HSPs)
chr7 (111-195)||(35184065-35184149)


Alignment Details
Target: chr7 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 111 - 195
Target Start/End: Complemental strand, 35184149 - 35184065
Alignment:
111 tactaatgtgtttgtgaagtgaatacaatggcaccagtcctactacgtcgtcttcctctccttcgcttcatggcttctcgcactt 195  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35184149 tactaatgtgtttgtgaagtgaatacaatggcaccagtcctactacgtcgtcttcctctccttcgcttcatggcttctcgcactt 35184065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University