View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16678_high_42 (Length: 212)
Name: NF16678_high_42
Description: NF16678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16678_high_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 15 - 194
Target Start/End: Original strand, 46632117 - 46632296
Alignment:
| Q |
15 |
cataggtcacgggaattaacaaacttattcttaaaactcaaannnnnnngtttaagtaaacttaaaactcaattagtgcctagaaaattgcttcttttgt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| | || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46632117 |
cataggtcacgggaattaacaaacttattcttaaaactcaattttttttgcttgagtaaacttaaaactcaattagtgcctagaaaattgcttcttttgt |
46632216 |
T |
 |
| Q |
115 |
gtgttgtaaaatccaaagtaaaacatgttacattataaaattgtttagtctatccaaatgaggaacaatatgaagtagtt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46632217 |
gtgttgtaaaatccaaagtaaaacatgttacattataaaattgtttagtctatccaaatgaggaacaatatgaagtagtt |
46632296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University