View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16678_low_38 (Length: 250)
Name: NF16678_low_38
Description: NF16678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16678_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 6018820 - 6018620
Alignment:
| Q |
1 |
ttttaatgaagttttggattggatttgaatttgaaaaccgcgctttagctatctcacgcgccaataaattcgcctttggcggttcaaattttgggaggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6018820 |
ttttaatgaagttttggattggatttgaatttgaaaaccgcgctttagctgtctcacgcgccaataaattcgcctttggcggttcaaattttgggaggat |
6018721 |
T |
 |
| Q |
101 |
tacacgatacgcttcgtccaaaatactgtaaactatttatcaattaataa-aaaatacatttatgttaattaaattacttttaagatgtgtacaaggttc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6018720 |
tacacgatacgcttcgtccaaaatactgtaaactatttatcaattaataaaaaaatacatttatgttaattaaattacttttaagatgtgtacaaggttc |
6018621 |
T |
 |
| Q |
200 |
t |
200 |
Q |
| |
|
| |
|
|
| T |
6018620 |
t |
6018620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University