View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16679_low_8 (Length: 284)
Name: NF16679_low_8
Description: NF16679
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16679_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 49 - 263
Target Start/End: Complemental strand, 34175394 - 34175179
Alignment:
| Q |
49 |
tgaaaacacaatataagtataagaaagtcgttctaaaaa-ttgtcacaaaattataagggcctacctgcattatgtttttatttactctctccattactt |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34175394 |
tgaaaacacaatataagtataagaaagtcgttctaaaaaattgtcacaaaattattagggcctacctgcattatgtttttatttactctctctattactt |
34175295 |
T |
 |
| Q |
148 |
tggnnnnnnngccaatacttaattttctttataaaatttaggttgtcttataaatcgatgtttaaataacaaaatgtaaacaaaaaagaacattaatcat |
247 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34175294 |
tggtttttttgccaatacttaattttctttataaaatttaggttgtcttataaatcgatgtttaaataacaaaacgtaaacaaaaaagaacattaatcat |
34175195 |
T |
 |
| Q |
248 |
ttgagtcggctaggat |
263 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
34175194 |
ttgagtcggctaggat |
34175179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University