View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16680_high_3 (Length: 221)
Name: NF16680_high_3
Description: NF16680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16680_high_3 |
 |  |
|
| [»] chr4 (14 HSPs) |
 |  |
|
| [»] chr6 (12 HSPs) |
 |  |
|
| [»] scaffold0515 (1 HSPs) |
 |  |
|
| [»] scaffold0306 (1 HSPs) |
 |  |
|
| [»] chr8 (11 HSPs) |
 |  |
|
| [»] chr5 (12 HSPs) |
 |  |
|
| [»] chr7 (14 HSPs) |
 |  |
|
| [»] chr3 (14 HSPs) |
 |  |
|
| [»] chr2 (11 HSPs) |
 |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |
|
| [»] scaffold0022 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 7e-82; HSPs: 11)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 1 - 183
Target Start/End: Complemental strand, 4256707 - 4256525
Alignment:
| Q |
1 |
ttaattcatcaacgatgattgatgaatatagttctatatnnnnnnntttattcatattttctttaattataaaagtaggttatacataaacacttgtata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4256707 |
ttaattcatcaacgatgattgatgaatatagttctatataaaattttttattcatattgtctttaattataaaagtaggttatacataaacacttgtata |
4256608 |
T |
 |
| Q |
101 |
ataataacttatgcaataagtgctttattattgtctacctaaatgcattggcagtttttctataaactcccacttcatacata |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4256607 |
ataataacttatgcaataagtgctttattactgtctacctaaatgcattggcagtttttctataaactcccacttcatacata |
4256525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 221
Target Start/End: Original strand, 2951358 - 2951404
Alignment:
| Q |
175 |
tcatacatactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| ||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
2951358 |
tcatacttactagactttccacccgtgctgccgcacgggtcatatac |
2951404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 180 - 221
Target Start/End: Original strand, 38913744 - 38913785
Alignment:
| Q |
180 |
catactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
38913744 |
catactagactttccacccgtgctgccgcacgggtcatatac |
38913785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 4266612 - 4266572
Alignment:
| Q |
181 |
atactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
4266612 |
atactagactttccacccgtgctgccgcacgggtcatatac |
4266572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 29942249 - 29942209
Alignment:
| Q |
181 |
atactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
29942249 |
atactagactttccacccgtgctgccgcacgggtcatatac |
29942209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 221
Target Start/End: Complemental strand, 1232026 - 1231987
Alignment:
| Q |
182 |
tactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
1232026 |
tactagactttccacccgtgctgccgcacgggtcatatac |
1231987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 178 - 221
Target Start/End: Original strand, 31018195 - 31018238
Alignment:
| Q |
178 |
tacatactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||| |||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
31018195 |
tacacactagactttccacccgtgctgccgcacgggtcatatac |
31018238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Complemental strand, 9216260 - 9216222
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
9216260 |
actagactttccacccgtgctgccgcacgggtcatatac |
9216222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 18855233 - 18855271
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
18855233 |
actagactttccacccgtgctgccgcacgggtcatatac |
18855271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 34888686 - 34888724
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
34888686 |
actagactttccacccgtgctgccgcacgggtcatatac |
34888724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 221
Target Start/End: Complemental strand, 50326228 - 50326192
Alignment:
| Q |
185 |
tagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
50326228 |
tagactttccacccgtgctgccgcacgggtcatatac |
50326192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 14)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 39058357 - 39058395
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39058357 |
actagattttccacctgtgctgccgcacgggtcatatac |
39058395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 16917888 - 16917926
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
16917888 |
actagactttccacctgtgctgccgcacgggtcatatac |
16917926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 12090457 - 12090497
Alignment:
| Q |
181 |
atactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
12090457 |
atactagactttccacccgtgctgccgcacgggtcatatac |
12090497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 33139469 - 33139509
Alignment:
| Q |
181 |
atactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
33139469 |
atactagactttccacccgtgctgccgcacgggtcatatac |
33139509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 221
Target Start/End: Original strand, 30824921 - 30824960
Alignment:
| Q |
182 |
tactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
30824921 |
tactagactttccacccgtgctgccgcacgggtcatatac |
30824960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 221
Target Start/End: Complemental strand, 37651896 - 37651857
Alignment:
| Q |
182 |
tactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
37651896 |
tactagactttccacccgtgctgccgcacgggtcatatac |
37651857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 16904952 - 16904990
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
16904952 |
actagactttccacccgtgctgccgcacgggtcatatac |
16904990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Complemental strand, 18209740 - 18209702
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
18209740 |
actagactttccacccgtgctgccgcacgggtcatatac |
18209702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 31965969 - 31966007
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
31965969 |
actagactttccacccgtgctgccgcacgggtcatatac |
31966007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Complemental strand, 35760810 - 35760772
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
35760810 |
actagattttccacccgtgctgccgcacgagtcatatac |
35760772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 37590804 - 37590842
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
37590804 |
actagactttccacccgtgctgccgcacgggtcatatac |
37590842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Complemental strand, 52434853 - 52434815
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
52434853 |
actagactttccacccgtgctgccgcacgggtcatatac |
52434815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 53143262 - 53143300
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
53143262 |
actagatttttcacccgtgctgccgcacgggtcatatac |
53143300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 221
Target Start/End: Complemental strand, 46256261 - 46256225
Alignment:
| Q |
185 |
tagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
46256261 |
tagactttccacccgtgctgccgcacgggtcatatac |
46256225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 12)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 182 - 221
Target Start/End: Complemental strand, 13533997 - 13533958
Alignment:
| Q |
182 |
tactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13533997 |
tactagattttccacccgtgctgccgcacgggtcatatac |
13533958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 1405563 - 1405601
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1405563 |
actagattttccacccgtgctgccgcacgggtcatatac |
1405601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 8539784 - 8539744
Alignment:
| Q |
181 |
atactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
8539784 |
atactagactttccacccgtgctgccgcacgggtcatatac |
8539744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 221
Target Start/End: Original strand, 28099596 - 28099635
Alignment:
| Q |
182 |
tactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
28099596 |
tactagactttccacccgtgctgccgcacgggtcatatac |
28099635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 221
Target Start/End: Complemental strand, 33646172 - 33646133
Alignment:
| Q |
182 |
tactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
33646172 |
tactagactttccacccgtgctgccgcacgggtcatatac |
33646133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 162669 - 162707
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
162669 |
actagactttccacccgtgctgccgcacgggtcatatac |
162707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Complemental strand, 2267005 - 2266967
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
2267005 |
actagactttccacccgtgctgccgcacgggtcatatac |
2266967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Complemental strand, 3593122 - 3593084
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
3593122 |
actagactttccacccgtgctgccgcacgggtcatatac |
3593084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 12597265 - 12597303
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
12597265 |
actagactttccacccgtgctgccgcacgggtcatatac |
12597303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Complemental strand, 14671940 - 14671902
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
14671940 |
actagatcttccacctgtgctgccgcacgtgtcatatac |
14671902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 15044953 - 15044913
Alignment:
| Q |
181 |
atactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||||| |||||||| |||||||||||| |||||||||| |
|
|
| T |
15044953 |
atactagactttccacccgtgctgccgcacaggtcatatac |
15044913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 221
Target Start/End: Complemental strand, 19997892 - 19997856
Alignment:
| Q |
185 |
tagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
19997892 |
tagactttccacccgtgctgccgcacgggtcatatac |
19997856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0515 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0515
Description:
Target: scaffold0515; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 6061 - 6099
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6061 |
actagattttccacccgtgctgccgcacgggtcatatac |
6099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0306 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0306
Description:
Target: scaffold0306; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 6071 - 6109
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6071 |
actagattttccacccgtgctgccgcacgggtcatatac |
6109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000008; HSPs: 11)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 183 - 221
Target Start/End: Complemental strand, 28583084 - 28583046
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28583084 |
actagattttccacccgtgctgccgcacgggtcatatac |
28583046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 15961363 - 15961323
Alignment:
| Q |
181 |
atactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
15961363 |
atactagactttccacccgtgctgccgcacgggtcatatac |
15961323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 23353620 - 23353660
Alignment:
| Q |
181 |
atactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
23353620 |
atactagactttccacccgtgctgccgcacgggtcatatac |
23353660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 221
Target Start/End: Original strand, 6299019 - 6299058
Alignment:
| Q |
182 |
tactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
6299019 |
tactagactttccacccgtgctgccgcacgggtcatatac |
6299058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 995815 - 995853
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
995815 |
actagactttccacccgtgctgccgcacgggtcatatac |
995853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Complemental strand, 10478166 - 10478128
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
10478166 |
actagactttccacccgtgctgccgcacgggtcatatac |
10478128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Complemental strand, 18175610 - 18175572
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
18175610 |
actagactttccacccgtgctgccgcacgggtcatatac |
18175572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 30473884 - 30473922
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
30473884 |
actagactttccacccgtgctgccgcacgggtcatatac |
30473922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 32110861 - 32110899
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
32110861 |
actagactttccacccgtgctgccgcacgggtcatatac |
32110899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Complemental strand, 39997920 - 39997882
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
39997920 |
actagaatttccacccgtgctgccgcacgggtcatatac |
39997882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 183 - 220
Target Start/End: Original strand, 42308123 - 42308160
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatata |
220 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42308123 |
actagatcgtccacctgtgctgccgcacgggtcatata |
42308160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000008; HSPs: 12)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 179 - 221
Target Start/End: Complemental strand, 34110885 - 34110843
Alignment:
| Q |
179 |
acatactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
34110885 |
acatactagactttccacccgtgctgccgcacgggtcatatac |
34110843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 20655047 - 20655087
Alignment:
| Q |
181 |
atactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
20655047 |
atactagactttccacccgtgctgccgcacgggtcatatac |
20655087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 20874919 - 20874879
Alignment:
| Q |
181 |
atactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
20874919 |
atactagactttccacccgtgctgccgcacgggtcatatac |
20874879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 40177272 - 40177232
Alignment:
| Q |
181 |
atactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
40177272 |
atactagactttccacccgtgctgccgcacgggtcatatac |
40177232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Complemental strand, 1396218 - 1396180
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
1396218 |
actatattttccacccgtgctgccgcacgggtcatatac |
1396180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 2398942 - 2398980
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
2398942 |
actagactttccacccgtgctgccgcacgggtcatatac |
2398980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 10729442 - 10729480
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
10729442 |
actagactttccacccgtgctgccgcacgggtcatatac |
10729480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 16526306 - 16526344
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
16526306 |
actagactttccacccgtgctgccgcacgggtcatatac |
16526344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 182 - 220
Target Start/End: Original strand, 17373160 - 17373198
Alignment:
| Q |
182 |
tactagattttccacctgtgctgccgcacgggtcatata |
220 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
17373160 |
tactagactttccacccgtgctgccgcacgggtcatata |
17373198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 34107338 - 34107376
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
34107338 |
actagactttccacccgtgctgccgcacgggtcatatac |
34107376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 38246865 - 38246903
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
38246865 |
actagactttccacccgtgctgccgcacgggtcatatac |
38246903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 33375995 - 33375955
Alignment:
| Q |
181 |
atactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
33375995 |
atactaaactttccacccgtgctgccgcacgggtcatatac |
33375955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 14)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 13786401 - 13786361
Alignment:
| Q |
181 |
atactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
13786401 |
atactagactttccacccgtgctgccgcacgggtcatatac |
13786361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 221
Target Start/End: Complemental strand, 21342053 - 21342014
Alignment:
| Q |
182 |
tactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
21342053 |
tactagactttccacccgtgctgccgcacgggtcatatac |
21342014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 221
Target Start/End: Original strand, 38163338 - 38163377
Alignment:
| Q |
182 |
tactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
38163338 |
tactagactttccacccgtgctgccgcacgggtcatatac |
38163377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 16376545 - 16376583
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
16376545 |
actagactttccacccgtgctgccgcacgggtcatatac |
16376583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 21804572 - 21804610
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
21804572 |
actagactttccacccgtgctgccgcacgggtcatatac |
21804610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Complemental strand, 31373685 - 31373647
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
31373685 |
actagactttccacccgtgctgccgcacgggtcatatac |
31373647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 33916947 - 33916985
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
33916947 |
actagactttccacccgtgctgccgcacgggtcatatac |
33916985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Complemental strand, 40969120 - 40969082
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
40969120 |
actagactttccacccgtgctgccgcacgggtcatatac |
40969082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 42242154 - 42242192
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
42242154 |
actagactttccacccgtgctgccgcacgggtcatatac |
42242192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 183 - 220
Target Start/End: Original strand, 27903417 - 27903454
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatata |
220 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
27903417 |
actagactttccacccgtgctgccgcacgggtcatata |
27903454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 63 - 104
Target Start/End: Original strand, 47528038 - 47528079
Alignment:
| Q |
63 |
ttaattataaaagtaggttatacataaacacttgtataataa |
104 |
Q |
| |
|
||||||||| || ||| ||||||||||||||||||||||||| |
|
|
| T |
47528038 |
ttaattatagaaatagcttatacataaacacttgtataataa |
47528079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 17178235 - 17178275
Alignment:
| Q |
181 |
atactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||||| |||||||| ||||||||||| ||||||||||| |
|
|
| T |
17178235 |
atactagactttccacccgtgctgccgcatgggtcatatac |
17178275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 21670212 - 21670172
Alignment:
| Q |
181 |
atactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||||| |||||||| |||||||||||| |||||||||| |
|
|
| T |
21670212 |
atactagactttccacccgtgctgccgcacaggtcatatac |
21670172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 27138526 - 27138566
Alignment:
| Q |
181 |
atactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||||| |||||||| |||||||||||| |||||||||| |
|
|
| T |
27138526 |
atactagactttccacccgtgctgccgcacaggtcatatac |
27138566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 14)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 26949029 - 26948989
Alignment:
| Q |
181 |
atactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
26949029 |
atactagactttccacccgtgctgccgcacgggtcatatac |
26948989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 221
Target Start/End: Complemental strand, 3898652 - 3898613
Alignment:
| Q |
182 |
tactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
3898652 |
tactagactttccacccgtgctgccgcacgggtcatatac |
3898613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 221
Target Start/End: Complemental strand, 21098534 - 21098495
Alignment:
| Q |
182 |
tactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
21098534 |
tactagactttccacccgtgctgccgcacgggtcatatac |
21098495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 221
Target Start/End: Complemental strand, 34121585 - 34121546
Alignment:
| Q |
182 |
tactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
34121585 |
tactagactttccacccgtgctgccgcacgggtcatatac |
34121546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 221
Target Start/End: Original strand, 40014652 - 40014691
Alignment:
| Q |
182 |
tactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
40014652 |
tactagactttccacccgtgctgccgcacgggtcatatac |
40014691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 221
Target Start/End: Complemental strand, 49672792 - 49672753
Alignment:
| Q |
182 |
tactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
49672792 |
tactagactttccacccgtgctgccgcacgggtcatatac |
49672753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 1941720 - 1941758
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
1941720 |
actagactttccacccgtgctgccgcacgggtcatatac |
1941758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 4584434 - 4584472
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
4584434 |
actagactttccacccgtgctgccgcacgggtcatatac |
4584472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 6460168 - 6460206
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
6460168 |
actagactttccacccgtgctgccgcacgggtcatatac |
6460206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Complemental strand, 12264429 - 12264391
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
12264429 |
actagactttccacccgtgctgccgcacgggtcatatac |
12264391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 36076454 - 36076492
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
36076454 |
actagactttccacccgtgctgccgcacgggtcatatac |
36076492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 38653927 - 38653965
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
38653927 |
actagactttccacccgtgctgccgcacgggtcatatac |
38653965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 43363611 - 43363649
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
43363611 |
actagactttccacccgtgctgccgcacgggtcatatac |
43363649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 183 - 220
Target Start/End: Complemental strand, 54073259 - 54073222
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatata |
220 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
54073259 |
actagactttccacccgtgctgccgcacgggtcatata |
54073222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 11)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 41664741 - 41664701
Alignment:
| Q |
181 |
atactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
41664741 |
atactagactttccacccgtgctgccgcacgggtcatatac |
41664701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 221
Target Start/End: Complemental strand, 44902311 - 44902272
Alignment:
| Q |
182 |
tactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
44902311 |
tactagactttccacccgtgctgccgcacgggtcatatac |
44902272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Complemental strand, 6120781 - 6120743
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
6120781 |
actagactttccacccgtgctgccgcacgggtcatatac |
6120743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Complemental strand, 8700490 - 8700452
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
8700490 |
actagactttccacccgtgctgccgcacgggtcatatac |
8700452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Complemental strand, 18351780 - 18351742
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
18351780 |
actagactttccacccgtgctgccgcacgggtcatatac |
18351742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 19596363 - 19596401
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
19596363 |
actagactttccacccgtgctgccgcacgggtcatatac |
19596401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Complemental strand, 20545054 - 20545016
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
20545054 |
actagactttccacccgtgctgccgcacgggtcatatac |
20545016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Original strand, 27944796 - 27944834
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
27944796 |
actagactttccacccgtgctgccgcacgggtcatatac |
27944834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 25889037 - 25889077
Alignment:
| Q |
181 |
atactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
25889037 |
atactagactttccactcgtgctgccgcacgggtcatatac |
25889077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 41663468 - 41663428
Alignment:
| Q |
181 |
atactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||||| |||||||| ||||||||||| ||||||||||| |
|
|
| T |
41663468 |
atactagactttccacccgtgctgccgcatgggtcatatac |
41663428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 42442195 - 42442155
Alignment:
| Q |
181 |
atactagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||||| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
42442195 |
atactagactttccacccgtgttgccgcacgggtcatatac |
42442155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 221
Target Start/End: Complemental strand, 46503 - 46465
Alignment:
| Q |
183 |
actagattttccacctgtgctgccgcacgggtcatatac |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
46503 |
actagactttccacccgtgctgccgcacgggtcatatac |
46465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0022
Description:
Target: scaffold0022; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 182 - 220
Target Start/End: Original strand, 149049 - 149087
Alignment:
| Q |
182 |
tactagattttccacctgtgctgccgcacgggtcatata |
220 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
149049 |
tactagactttccacccgtgctgccgcacgggtcatata |
149087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University