View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16681_low_2 (Length: 407)
Name: NF16681_low_2
Description: NF16681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16681_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 359; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 359; E-Value: 0
Query Start/End: Original strand, 17 - 395
Target Start/End: Original strand, 10760130 - 10760508
Alignment:
| Q |
17 |
acattactattacatttttcttctcgttttgggtttctctcatgaaagatcatagaaaacatagcagagccatttcatggagcacattcttctggttcac |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10760130 |
acattactattacatttttcttctcgttttgggtttctctcatgaaagatcatagaaaacatagcagagccatttcatggagcacattcttttggttcac |
10760229 |
T |
 |
| Q |
117 |
tattgtggttgtcttatcttccattatctttacctccctaattatttcatccatccaccccttctacctccctcgatttcacatcccaattgcagctttg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10760230 |
tattgtggttgtcttatcttccattatctttacctccctaattatttcatccatccaccccttctacctccctcgatttcacatcccaattgcagctttg |
10760329 |
T |
 |
| Q |
217 |
aaatggccaactccagtgccaccccaaatcacaattcgggaaacagttatgcttcctgatcatgttttaatgttcttaaactaccctttatcttttcgct |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10760330 |
aaatggccaactccagtgccaccccaaatcacaattcgggaaacagttttgcttcctgatcatgttttaattttcttaaactaccctttatcttttcgct |
10760429 |
T |
 |
| Q |
317 |
atcacaccaaacatgaccttcaatgtgtttactcttcagatgatgactcaaaacctcgtctcactcaagaaccggttca |
395 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10760430 |
atcacaccaaacgtgaccttcaatgtgtttactcttcagatcatgactcaaaacctcgtctcactcaagaaccggttca |
10760508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University