View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16681_low_6 (Length: 253)
Name: NF16681_low_6
Description: NF16681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16681_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 45566055 - 45565820
Alignment:
| Q |
1 |
ttccattgatgaatgtcgggatgagttagatagatttaggggcagcgtgcaagcttcccaaattgggcgctctaaggaggtacatatttgaatgggagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
45566055 |
ttccattgatgaatgtcgggatgagttagagagatttaggggcagcgtgcaagcttcccaaattgcgcgctctaaggaggtacatatttgaatgagagga |
45565956 |
T |
 |
| Q |
101 |
ttattggcacaagcagaagcattttggaaacaaatagcaaaggtgatttggcttaaggatggtgacaccaatgcgcgattctttcaagccatggcgagtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45565955 |
ttattggcacaagcagaagcattttggaaacaaatagcaaaggtgatttggcttaaggatggtgataccaatgcgcgattctttcaagccatggcgagtg |
45565856 |
T |
 |
| Q |
201 |
caaagagatgatgcaatacttttacaaacttgaaga |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
45565855 |
caaagagatgatgcaatacttttacaaacttgaaga |
45565820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 165
Target Start/End: Complemental strand, 8179449 - 8179388
Alignment:
| Q |
104 |
ttggcacaagcagaagcattttggaaacaaatagcaaaggtgatttggcttaaggatggtga |
165 |
Q |
| |
|
|||||||||| |||||| |||||||| |||| ||| |||||||||||||| ||||||||||| |
|
|
| T |
8179449 |
ttggcacaagaagaagcgttttggaagcaaagagctaaggtgatttggctgaaggatggtga |
8179388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University