View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16681_low_7 (Length: 243)
Name: NF16681_low_7
Description: NF16681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16681_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 9 - 226
Target Start/End: Complemental strand, 5655736 - 5655504
Alignment:
| Q |
9 |
agcatagggttcaactcaaatggttctgtgtttcttgatggtaattataaattgcatttatttaccatttgaaaacattacatttctataggtcaaaata |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5655736 |
agcatagggttcaactcaaatggttctgtgtttcttgatggtaattataaattgcatttatttaccatttgaaaacattacatttctataggtcaaaata |
5655637 |
T |
 |
| Q |
109 |
tgttagtcaataggtaacactaataaaatgctgcacaa---------------agttttaatacttttacaaatcttgtttcaatttctgtttctttatg |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5655636 |
tgttagtcaataggtaacactaataaaatgctgcacaaattcacaagtactatagttttaatacttttacaaatcttgtttcaatttctgtttctttatg |
5655537 |
T |
 |
| Q |
194 |
atatctaattgtaaaatttggttacaggaatga |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
5655536 |
atatctaattgtaaaatttggttacaggaatga |
5655504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University