View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16681_low_8 (Length: 211)
Name: NF16681_low_8
Description: NF16681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16681_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 6 - 193
Target Start/End: Complemental strand, 33919924 - 33919738
Alignment:
| Q |
6 |
tgatatgaaccagtggatctcaaatgggaagaggatgtcataaagaaggttataaagagtctgggatgtggaagtgttgaacttgagcatcctcattcgg |
105 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33919924 |
tgataagaaccggtggatctcaaatgggaagaggatgtcataaagaaggttataaagagtctgagatgtggaagtgttgaacttgagcatcctcattcgg |
33919825 |
T |
|
| Q |
106 |
gagcacgactctccaatcgatagaagactcgacctttgtataatcatgtgctcttctaaagatccaggaacattgttcattgaggaaa |
193 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33919824 |
gagcatgactctccaatcgatagaagactcgacctttgtataatcatgtgctcttctaaagatcca-aaacattgttcattgaggaaa |
33919738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 6 - 193
Target Start/End: Complemental strand, 33920416 - 33920230
Alignment:
| Q |
6 |
tgatatgaaccagtggatctcaaatgggaagaggatgtcataaagaaggttataaagagtctgggatgtggaagtgttgaacttgagcatcctcattcgg |
105 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33920416 |
tgataagaaccggtggatctcaaatgggaagaggatgtcataaagaaggttataaagagtctgagatgtggaagtgttgaacttgagcatcctcattcgg |
33920317 |
T |
|
| Q |
106 |
gagcacgactctccaatcgatagaagactcgacctttgtataatcatgtgctcttctaaagatccaggaacattgttcattgaggaaa |
193 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33920316 |
gagcatgactctccaatcgatagaagactcgacctttgtataatcatgtgctcttctaaagatcca-aaacattgttcattgaggaaa |
33920230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University