View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16682_high_11 (Length: 311)
Name: NF16682_high_11
Description: NF16682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16682_high_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 301
Target Start/End: Complemental strand, 53661267 - 53660960
Alignment:
| Q |
1 |
tacaccgggacctcaagtcagctaatcttttgatagataagactggagtaagctcacattgattacttttaaattttactggcttattgtattttagttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53661267 |
tacaccgggacctcaagtcagctaatcttttgatagataagactggagtaagctcacattgattacttttaaattttactggcttattgtattttagttg |
53661168 |
T |
|
| Q |
101 |
atgctgtctgtttatatttgtcgatggaattcctgttggataagttattgcatgtcctctatctgattatatatggaaactaaagttgattggcgattca |
200 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
53661167 |
atgctgtcggtttatatttgtcaatggaattcctgttggataagttattgcatgtcctctatctgattatatatggaaactaaagttgattggcgataca |
53661068 |
T |
|
| Q |
201 |
agttact---aagtgattgagttttggcagaagatggaaagaaaatagatttacttaacttttggagtcaataatgtat----agtaagtgattgagtat |
293 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
53661067 |
agttactaagaagtgattgagttttggcagaagatggaaagaaaatagatttacttaacttttggagtcaataatgtatagtaagtaagtgattgagtat |
53660968 |
T |
|
| Q |
294 |
cctctctg |
301 |
Q |
| |
|
|||||||| |
|
|
| T |
53660967 |
cctctctg |
53660960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University