View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16682_high_18 (Length: 236)
Name: NF16682_high_18
Description: NF16682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16682_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 3 - 165
Target Start/End: Complemental strand, 45790230 - 45790068
Alignment:
| Q |
3 |
gtgtccatgcaaatgctactcaattggtagctgcactaacgttgataatcccatatactgctccaaatttaatgtgtgagtatagcactaggctacttga |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
45790230 |
gtgtccatgcaaatgctactcaattggtagctgcactaacgttgataatcccatatactgctccaaacttaatgtgtgagtatggcactaggctacttga |
45790131 |
T |
 |
| Q |
103 |
tcnnnnnnnnnnnnnccaattcaagttgtgttgtctaggagcaacttaaagataaagacacaa |
165 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45790130 |
taaaaaaagaaaaaaccaattcaagttgtgttgtctaggagcaacttaaagacaaagacacaa |
45790068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University