View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16682_high_6 (Length: 409)
Name: NF16682_high_6
Description: NF16682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16682_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 84; Significance: 9e-40; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 93 - 235
Target Start/End: Complemental strand, 49310871 - 49310730
Alignment:
| Q |
93 |
gttggtgatgatggatcgtcatcgtgcgtatctaaaaacatcttgaatctatctttgaccatcgtacttctctctctcttaacatattttcnnnnnnnnn |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
49310871 |
gttggtgatgatggatcgtcatcgtgcgtatctaaaaacatcttgaatctatctttgaccatcgtactt-tctctctcttaacatattttctcatcatca |
49310773 |
T |
 |
| Q |
193 |
nnnnnnnncttcttcaccttttcgccgctgttgcagactcttt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
49310772 |
tcatcatccttcttcaccttttcgccgctgttgcagactcttt |
49310730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 291 - 320
Target Start/End: Complemental strand, 49310674 - 49310645
Alignment:
| Q |
291 |
tagatagtgaaagaaagagagagaatatac |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
49310674 |
tagatagtgaaagaaagagagagaatatac |
49310645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University