View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16682_low_16 (Length: 262)
Name: NF16682_low_16
Description: NF16682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16682_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 130 - 247
Target Start/End: Complemental strand, 36333879 - 36333762
Alignment:
| Q |
130 |
gagagtaatatgctgctttatggtttccaacccctgttgtggtgcctgcagatattaatttagaaataatggattgtgttgctacacttttgaattaatg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36333879 |
gagagtaatatgctgctttatggtttccaacccctgttgtggtgcctgcagatattaatttggaaataatggattgtgttgctacacttttgaattaatg |
36333780 |
T |
 |
| Q |
230 |
ttgaagaaattgatcctg |
247 |
Q |
| |
|
|||||| ||||||||||| |
|
|
| T |
36333779 |
ttgaagtaattgatcctg |
36333762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 16 - 103
Target Start/End: Complemental strand, 36333996 - 36333909
Alignment:
| Q |
16 |
aatataatgtcaagcatgtgcatgattcagttttccatcttgctgtggcatacaattggaattgaaacaaggaaataatgaggcacct |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36333996 |
aatataatgtcaagcatgtgcatgattcagttttccatcttgctgtggcatacaattggaattgaaacaaggaaataatgaggcacct |
36333909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University