View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16683_low_8 (Length: 236)
Name: NF16683_low_8
Description: NF16683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16683_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 6e-95; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 176
Target Start/End: Complemental strand, 4408217 - 4408042
Alignment:
| Q |
1 |
ctgcatcgatattcataaggtaacccctttaatcaatattaacttcttgccaattcatgtcaaaaaggaccgatttttacatgtgggtttttatgggaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4408217 |
ctgcatcgatattcataaggtaacccctttaatcaatattaacttcttgccaattcatgtcaaaaaggaccgatttttacatgtgggtttttatgggaat |
4408118 |
T |
|
| Q |
101 |
gacattttatgacgtgggtgattgtgtttttgtaggggaaagtgaaacaaattgttgggtcaacccttaaagattt |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4408117 |
gacattttatgacgtgggtgattgtgtttttgtaggggaaagtgaaacaaattgttgggtcaacccttaaagattt |
4408042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 172 - 236
Target Start/End: Original strand, 4407991 - 4408055
Alignment:
| Q |
172 |
gatttatcagactcaaaattagtgattggatctgacccatcatcatctttcaaatctttaagggt |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4407991 |
gatttatcagactcaaaattagtgattggatctgacccatcatcatctttcaaatctttaagggt |
4408055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University