View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16684_high_6 (Length: 291)
Name: NF16684_high_6
Description: NF16684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16684_high_6 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 5 - 291
Target Start/End: Complemental strand, 39937186 - 39936900
Alignment:
| Q |
5 |
gactgatatgaatcatgtgttccagctgaggtgatcacattattatctacctgatttgctgcttgcattctggatgaaccaggtgttggaacatgcggca |
104 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39937186 |
gactgatttgaatcatgtgttccagctgaggtgatcacattattatctacctgatttgctgcttgcattctggatgaaccaggtgttggaacatgcggca |
39937087 |
T |
 |
| Q |
105 |
tatggaaaggaggcatcgcgaaccttggtcccaaattcgcggctgcaggcaaagcagaaccggataacatattgggaaatggcattactggtctgtttat |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39937086 |
tatggaaaggaggcatcgcgaaccttggtcccaaatttgcggctgcaggcaaagcagaaccggataacatattgggaaatggcattactggtctgtttat |
39936987 |
T |
 |
| Q |
205 |
tcccatttccatacccatccccattcccattccaaccgttggcatatactgctggattccaggaaacatcataggtaccatgccaca |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39936986 |
tcccatttccatacccatccccattcccattccaaccgttggcatatactgctggattccaggaaacatcataggtaccatgccaca |
39936900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 170 - 291
Target Start/End: Original strand, 29729995 - 29730128
Alignment:
| Q |
170 |
aacatattgggaaatggcattactggtctgtttattcccatttccat------------acccatccccattcccattccaaccgttggcatatactgct |
257 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||| ||||||||| |||| |||||| ||||| |||||||| | || |||||| | |||| |
|
|
| T |
29729995 |
aacatattaggaaatggcatcactggtctgttcattcccattcccatttccatccctaaacccattcccatccccattcccatcgccggcataaattgct |
29730094 |
T |
 |
| Q |
258 |
ggattccaggaaacatcataggtaccatgccaca |
291 |
Q |
| |
|
| |||||||||||||||||||||||||||||||| |
|
|
| T |
29730095 |
gaattccaggaaacatcataggtaccatgccaca |
29730128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 56 - 135
Target Start/End: Original strand, 29729863 - 29729948
Alignment:
| Q |
56 |
tgatttgctgcttgcattctggatgaaccaggtgttg------gaacatgcggcatatggaaaggaggcatcgcgaaccttggtcc |
135 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||| | ||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
29729863 |
tgattttctgcttgcattctggatgaatcaggtgcagctgcaggaacatggggcacatggaaaggaggcatagcgaaccttggtcc |
29729948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University