View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16684_low_10 (Length: 245)
Name: NF16684_low_10
Description: NF16684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16684_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 4e-53; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 50 - 196
Target Start/End: Complemental strand, 1251612 - 1251475
Alignment:
| Q |
50 |
gtaaagggtgtcttcatttcacaattcacatggatgagatggtaatttaaaattgaataggaaaacaaataaattaaatcaaacatagctaacaaaatgg |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1251612 |
gtaaagggtgtcttcatttcacaattcacatggatgagatggtaatttaaaat-----aggaaaacaaataaa----atcaaacatagctaacaaaatgg |
1251522 |
T |
|
| Q |
150 |
cagggttaattttcatgtatgcaaaatcttgcttcttccaacattgt |
196 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1251521 |
caggattaattttcatgtatgcaaaatcttgcttcttccaacattgt |
1251475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 177 - 226
Target Start/End: Complemental strand, 15029052 - 15029003
Alignment:
| Q |
177 |
cttgcttcttccaacattgtctaataatattagcaatgtcagggtccata |
226 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||| |||||| ||||| |
|
|
| T |
15029052 |
cttgcttcttcaaacattgtctaataatattagtaatatcaggggccata |
15029003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 226
Target Start/End: Complemental strand, 15007817 - 15007768
Alignment:
| Q |
177 |
cttgcttcttccaacattgtctaataatattagcaatgtcagggtccata |
226 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||| ||| |||||| ||||| |
|
|
| T |
15007817 |
cttgtttcttcaaacattgtctaataatattagtaatatcaggggccata |
15007768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 177 - 226
Target Start/End: Complemental strand, 15021934 - 15021885
Alignment:
| Q |
177 |
cttgcttcttccaacattgtctaataatattagcaatgtcagggtccata |
226 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||| ||| |||||| ||||| |
|
|
| T |
15021934 |
cttgattcttcaaacattgtctaataatattagtaatatcaggggccata |
15021885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University