View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16684_low_12 (Length: 239)
Name: NF16684_low_12
Description: NF16684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16684_low_12 |
 |  |
|
| [»] scaffold0010 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0010 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 17 - 153
Target Start/End: Original strand, 252081 - 252217
Alignment:
| Q |
17 |
caaaggtcgtgtcggagaatagtgagagctatgaggaaaaatgtgattctgaatggaactggtatgcgcccgtatcaatgacttctagactttacgacag |
116 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
252081 |
caaaggtcgtgttggagaatagtgagagctatgaggaaaaatgtgattctgaatggaactggtatgcgcccgtatcaacgacttctagactttacgacag |
252180 |
T |
 |
| Q |
117 |
tgaatcgtggttagaagtctcttctcgatttttcttt |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
252181 |
tgaatcgtggttagaagtctcttctcgatttttcttt |
252217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 165 - 227
Target Start/End: Original strand, 252285 - 252350
Alignment:
| Q |
165 |
caggttcctttcaaaagta---aagtgtgaaaagacaaaagtttttaactggaaacataaattgct |
227 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
252285 |
caggttcctttcaaaagtagtaaagtgtgaaaagacaaaagtttttaactggaaacataaattgct |
252350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University