View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16685_low_5 (Length: 424)
Name: NF16685_low_5
Description: NF16685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16685_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 1e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 269 - 414
Target Start/End: Complemental strand, 9144635 - 9144488
Alignment:
| Q |
269 |
aggggtgtcaccagtgacatatccaacaaggtcacgtgcaacaaggag--aatgaatttgtttataccaagcagggtaattattggagtttagtttaatg |
366 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| || |||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9144635 |
aggggtgtcaccagtgacatatccaataaggtcacgtgcaacaagaagggaatgaatttgtttataccaagcagggtaattagaggagtttagtttaatg |
9144536 |
T |
|
| Q |
367 |
ggaaggtgagcggaagtgttagactctagtaactcttttggttctgtg |
414 |
Q |
| |
|
|||||||||| |||||| || ||||||||||||||||||||||||||| |
|
|
| T |
9144535 |
ggaaggtgagtggaagtattggactctagtaactcttttggttctgtg |
9144488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 283 - 376
Target Start/End: Original strand, 20251552 - 20251647
Alignment:
| Q |
283 |
tgacatatccaacaaggtcacgtgcaacaag--gagaatgaatttgtttataccaagcagggtaattattggagtttagtttaatgggaaggtgag |
376 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| |||||| |||||| ||||||||||| || ||||| ||||| ||||| ||||||||||||| |
|
|
| T |
20251552 |
tgacatatcccacaaggtcatgtgcaacaagaagagaatcaatttgattataccaagctggataattggaagagttaagtttgatgggaaggtgag |
20251647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 273 - 313
Target Start/End: Original strand, 23902253 - 23902293
Alignment:
| Q |
273 |
gtgtcaccagtgacatatccaacaaggtcacgtgcaacaag |
313 |
Q |
| |
|
||||||||| | |||||||||||||||||||||| |||||| |
|
|
| T |
23902253 |
gtgtcaccaatcacatatccaacaaggtcacgtgaaacaag |
23902293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University