View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16685_low_6 (Length: 331)
Name: NF16685_low_6
Description: NF16685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16685_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 67 - 314
Target Start/End: Complemental strand, 8088712 - 8088451
Alignment:
| Q |
67 |
gatgccatcttttacttgcgacggcaattagactctaagttagatgatacaagtggtagcatgtttaattaatacaaataaatacatgccccaagcctgc |
166 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||| ||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
8088712 |
gatgccatcttttacttgcgacggcaatttgattctaagttagatgatacaggtggtagaatgtttaatcaatacaaataaatgcatgccccaagcctgc |
8088613 |
T |
|
| Q |
167 |
acaattgg----------acagtgtctaggccattttagattactacaaaatttaatac----tagactagatagggaagacaaatttttgacataattt |
252 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8088612 |
acaaatgggagataatggacagtgtctaggccattttagattactacaaattttaatacgtactagactagatagggaagagaaatttttgacataattt |
8088513 |
T |
|
| Q |
253 |
acacatcaaattttgatattaatctgaaacgttaatgcaattcaaatatgtggttaactata |
314 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8088512 |
acacatcaaattttgatattaatctgaaatgttaatgcaattcaaatatgtggttaactata |
8088451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University