View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16686_high_12 (Length: 259)
Name: NF16686_high_12
Description: NF16686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16686_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 46914395 - 46914641
Alignment:
| Q |
1 |
ttggtgggggttggagaaggacattttggtgtttcaatgttgttttgnnnnnnnnataattgcagagattaaatagttttgtttgttttcagttatcata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
46914395 |
ttggtgggggttggagaaggacattttggtgtttcaatgttgttttgttttttttataattgcagagtttaaatagttttgtttgttttcagttatcata |
46914494 |
T |
|
| Q |
101 |
gtactaatctctaggnnnnnnn-atctttttgtgaaagaaaataaaaggtatgctgtaatttcttggaatttattgtttgatgttgttggtagagatcgt |
199 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46914495 |
gtactaatctctaggttttttttatctttttgtgaaagaaaataaaaagtatgctgtaatttcttggaatttattgtttgatgttgttggtagagatcgt |
46914594 |
T |
|
| Q |
200 |
gggtgacaaacagagttcgtttattgtccttgtgtttgttgttgctg |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46914595 |
gggtgacaaacagagttcgtttattgtccttgtgtttgttgttgctg |
46914641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University