View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16686_low_12 (Length: 263)
Name: NF16686_low_12
Description: NF16686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16686_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 10 - 244
Target Start/End: Original strand, 24257211 - 24257448
Alignment:
| Q |
10 |
gtgagatgaacaaacttaatgtaaggagacatgtcttgaagaagctgaaaggctgagagtatgtctgtttggtgcggtccagtgagtaggcagagtttgt |
109 |
Q |
| |
|
|||| |||| ||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24257211 |
gtgaaatgagcaaacttaacgtaaggagacatgtcttgaagaagctgaaaggccgagagtatgtctgtttggtgcggtccagtgagtaggcagagtttgt |
24257310 |
T |
|
| Q |
110 |
ggtgacca---cagtcggtgccatttagcagagtttggagggcgtcggtgaaatacgcagcgagtctctccatgttggtgccgtgagtggaggacactaa |
206 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24257311 |
ggtgaccaccacagtcggtgccatttagcagagtttggagggcgtcggtgaaatacgcagcgagtctctccatgttggtgccgtgagtggaggacactaa |
24257410 |
T |
|
| Q |
207 |
gtccttgagccgaatcaatatcacttgagccagatggt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24257411 |
gtccttgagccgaatcaatatcacttgagccagatggt |
24257448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University