View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16687_low_4 (Length: 258)
Name: NF16687_low_4
Description: NF16687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16687_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 58 - 171
Target Start/End: Original strand, 43628766 - 43628877
Alignment:
| Q |
58 |
ggtggatcctatctctcttgaaattgcaacaattagnnnnnnnnttataaatgaggagaatgttaatccaaggaagaagatgatgaaggaacaaatcaca |
157 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43628766 |
ggtggatcctatctctcttcaaattgaaacaattagaaaaaa--ttataaatgaggaggatgttaatccaaggaagaagatgatgaaggaacaaatcaca |
43628863 |
T |
 |
| Q |
158 |
tgtctttcactaaa |
171 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
43628864 |
tgtctttcactaaa |
43628877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 42613180 - 42613145
Alignment:
| Q |
1 |
tttataaatttttttcatttgttgcaatttgaagaga |
37 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42613180 |
tttataaatttttt-catttgttgcaatttgaagaga |
42613145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University