View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16688_high_34 (Length: 381)
Name: NF16688_high_34
Description: NF16688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16688_high_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 13 - 255
Target Start/End: Original strand, 37842120 - 37842361
Alignment:
| Q |
13 |
cacaaattgcaactaattagtggggaaaaacacctaaaacagaaaattaaggtcctcgtcttggataacaatacgttttggagggctaggtctccgattt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37842120 |
cacaaattgcaactaattagtggggaaaaacacctaaaacataaaattaaggtcctcgtcttggataacaatacgttttggagggctaggtctccgattt |
37842219 |
T |
 |
| Q |
113 |
tattagtgtaatagtcttctatcatgagatgtactttgaacatatatcatatattagtcctcacaattttattttattttcatgattagtgtacagaata |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37842220 |
tattagtgtaatagtcttctatcatgagatgtactttgaacatatatcatatattagtcctcacaattttatttt-ttttcatgattagtgtacagaata |
37842318 |
T |
 |
| Q |
213 |
ctatttccacttctctaaaaagataggtgtttccctcaactct |
255 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37842319 |
ctattttcacttctctaaaaagataggtgtttctctcaactct |
37842361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 274 - 322
Target Start/End: Original strand, 37842359 - 37842407
Alignment:
| Q |
274 |
tctctcaatggcatttgcatcctcttctctccaattcacaccattaaca |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37842359 |
tctctcaatggcatttgcatcctcttctctccaattcacaccattaaca |
37842407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University