View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16688_high_36 (Length: 372)
Name: NF16688_high_36
Description: NF16688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16688_high_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 332; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 10 - 357
Target Start/End: Complemental strand, 32164667 - 32164320
Alignment:
| Q |
10 |
agaagagattaagaaaaagatggtgcttctttggagaagctaactagtgccattccgacagaggtccgattgcataaaatatatcgggagatattgtctg |
109 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32164667 |
agaagagattaagaaaaagatggtgctcctttggagaagctaacttgtgccattccgacagaggtccgattgcataaaatatatcgggagatattgtctg |
32164568 |
T |
 |
| Q |
110 |
atcggcttttttagcatcagaagccatttcccgatcagacgaagagaggttagatatctaaaaattaggaagagatacttttaaacttccgagtggtggt |
209 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32164567 |
atcggcttttttagcatcagaagctatttcccgatcagacgaagagaggttagatatctaaaaattaggaagagatacttttaaactttcgagtggtggt |
32164468 |
T |
 |
| Q |
210 |
aaacatgtgcttccatatggaggaaaacggtttctagaaatggtggtcaccgaaaaccacgttctagtcggagttttgatttaggggtttttattgcggg |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32164467 |
aaacatgtgcttccatatggaggaaaacggtttctagaaatggtggtcaccgaaaaccacgttctagtcggagttttgatttaggggtttttattgcggg |
32164368 |
T |
 |
| Q |
310 |
cctctagaggagttgatgcatcggctatgattcttggagagagcttct |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32164367 |
cctctagaggagttgatgcatcggctatgattcttggagagagcttct |
32164320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University