View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16688_high_67 (Length: 252)
Name: NF16688_high_67
Description: NF16688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16688_high_67 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 19 - 235
Target Start/End: Complemental strand, 46951883 - 46951667
Alignment:
| Q |
19 |
atttcattcataatcttttagagaaactcaaacactccctctctcttgctttattccatttctatcctttatcaggtcgtcttgttacacaaaaatccca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46951883 |
atttcattcataatcttttagagaaactcaaacactccctctctcttgctttatttcatttctatcctttatcaggtcgtcttgttacacaaaaatccca |
46951784 |
T |
|
| Q |
119 |
agaccctcccacttataatattttcgttgattgcagtaacaataactccggagctagattcatccatgcaactttggatgcaacagtatctgatatcatg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46951783 |
agaccctcccacttataatattttcgttgattgcagtaacaataactccggagctagattcatccatgcaactttggatgcaacagtatctgatatcatg |
46951684 |
T |
|
| Q |
219 |
acaccaattgatgttcc |
235 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
46951683 |
acaccaattgatgttcc |
46951667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 39 - 215
Target Start/End: Complemental strand, 46956221 - 46956045
Alignment:
| Q |
39 |
gagaaactcaaacactccctctctcttgctttattccatttctatcctttatcaggtcgtcttgttacacaaaaatcccaagaccctcccacttataata |
138 |
Q |
| |
|
||||| |||||||||||| |||||| |||| | ||||||||||||||| | || || || ||||| || || ||| | |||||||||||| |||||| | |
|
|
| T |
46956221 |
gagaagctcaaacactccttctctcatgctcttttccatttctatcctctttctggccgccttgtcacccacaaaactcaagaccctccctcttatacca |
46956122 |
T |
|
| Q |
139 |
ttttcgttgattgcagtaacaataactccggagctagattcatccatgcaactttggatgcaacagtatctgatatc |
215 |
Q |
| |
|
|||| ||||||||||||||| ||||| || |||||||||||||| |||||||| ||||||||||| ||| ||||||| |
|
|
| T |
46956121 |
tttttgttgattgcagtaacgataacaccagagctagattcatctatgcaactctggatgcaacaatatatgatatc |
46956045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 52 - 187
Target Start/End: Complemental strand, 46959043 - 46958908
Alignment:
| Q |
52 |
actccctctctcttgctttattccatttctatcctttatcaggtcgtcttgttacacaaaaatcccaagaccctcccacttataatattttcgttgattg |
151 |
Q |
| |
|
|||||||||||| |||| | ||||||||||||||| | || || || ||||| || || ||| | ||| |||||||| |||||| ||||| |||||||| |
|
|
| T |
46959043 |
actccctctctcatgctcttttccatttctatcctctttctggccgccttgtcacccacaaaactcaacaccctccctcttataccatttttgttgattg |
46958944 |
T |
|
| Q |
152 |
cagtaacaataactccggagctagattcatccatgc |
187 |
Q |
| |
|
|||||||||||| | ||||||||||||||| |||| |
|
|
| T |
46958943 |
tagtaacaataaccctggagctagattcatctatgc |
46958908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 126
Target Start/End: Complemental strand, 46996114 - 46996030
Alignment:
| Q |
42 |
aaactcaaacactccctctctcttgctttattccatttctatcctttatcaggtcgtcttgttacacaaaaatcccaagaccctc |
126 |
Q |
| |
|
||||||||||||||||| || || | | |||||||||||||| | ||||||||||||||||| |||||||| |||| |||| |
|
|
| T |
46996114 |
aaactcaaacactccctttccctcacacttttccatttctatcccctctcaggtcgtcttgttactaaaaaatccgaagatcctc |
46996030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University