View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16688_high_78 (Length: 237)
Name: NF16688_high_78
Description: NF16688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16688_high_78 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 17 - 227
Target Start/End: Complemental strand, 27255820 - 27255610
Alignment:
| Q |
17 |
attataaccctcttaacacaaatatagagcatgacatgttgtctataattgtaaaatcattgtttatgaagtgattttagaatgatagaatcctatagta |
116 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27255820 |
attataaccctcttaacgcaaatatagagcatgaaatgttgtctataattgtaaaatcattgtttatgaagtgattttagaatgatagaatcctatagta |
27255721 |
T |
 |
| Q |
117 |
tatgattaggtctttatgctctatgatgccagttttgatatttgattcataatgtgtcttttggcctttaggtcattattttgtcttagcatcgaatatg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27255720 |
tatgattaggtctttatgctctatgatgtcagttttgatatttgattcataatgtatcttttggcctttaggtcattattttgtgttagcatcgaatatg |
27255621 |
T |
 |
| Q |
217 |
ttagcattctt |
227 |
Q |
| |
|
||||||||||| |
|
|
| T |
27255620 |
ttagcattctt |
27255610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 17 - 131
Target Start/End: Complemental strand, 21199800 - 21199686
Alignment:
| Q |
17 |
attataaccctcttaacacaaatatagagcatgacatgttgtctataattgtaaaatcattgtttatgaagtgattttagaatgatagaatcctatagta |
116 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21199800 |
attataaccctcttaacgcaaatatagagcatgaaatgttgtctataattgtaaaatcattgtttatgaagtgattttagaatgatagaatcctatagta |
21199701 |
T |
 |
| Q |
117 |
tatgattaggtcttt |
131 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
21199700 |
tatgattaggtcttt |
21199686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University