View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16688_high_87 (Length: 219)
Name: NF16688_high_87
Description: NF16688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16688_high_87 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 42965386 - 42965183
Alignment:
| Q |
1 |
tgttgtgcacacacaaaacaagaccaaccaaaggaagccacttagaggttgcaaatcagcttcttcggtgagtgagtgagtgctcttctgtcactgtata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42965386 |
tgttgtgcacacacaaaacaagaccaaccaaaggaagccacttagaggttgcaaatcagcttcttcggtgagtgagtgagtgctcttctgtcactgtata |
42965287 |
T |
|
| Q |
101 |
cccaccaatggcaactcttggtgctgtcaaattcctgctctgtctccttatgatatggctcatcaactttctacctctatgccaaggtt-ttttgccccc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42965286 |
cccaccaatggcaactcttggtgctgtcaaattcctgctctgtctccttatgatatggctcatcaactttctacctctatgccaaggtttttttgccccc |
42965187 |
T |
|
| Q |
200 |
tcta |
203 |
Q |
| |
|
|||| |
|
|
| T |
42965186 |
tcta |
42965183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University