View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16688_low_30 (Length: 393)
Name: NF16688_low_30
Description: NF16688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16688_low_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 350; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 18 - 383
Target Start/End: Complemental strand, 43747263 - 43746898
Alignment:
| Q |
18 |
acaaacgaaattcacatcaagaaactgaaccactagctcggaacacagagtttccttgcagaacacgtttgcaaaagggtggtctactgaatgaagatac |
117 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43747263 |
acaaacaaaattcacatcaagaaactgaatcactagctccgaacacagagtttccttgcagaacacgtttgcaaaagggtggtctactgaatgaagatac |
43747164 |
T |
|
| Q |
118 |
atgaacacaaattttttatcttgttctgctaacttcatagcttcattgaaacgacaagcgtaaaagaagggatgtttgttgccatattgttgctcaaaat |
217 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43747163 |
atgaacacaaatttttgatcttgttctgctaacttcatagcttcattgaaacgacaagcgtaaaagaagggatgtttgttgccatattgttgctcaaaat |
43747064 |
T |
|
| Q |
218 |
tatcgtgaaaagcccattcttctggagctgctaaggaattttgtggttgtggagggtctaaaaattgtaatggaaagtttgcattttgatttcttcttct |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43747063 |
tatcgtgaaaagcccattcttctggagctgctaaggaattttgtggttgtggagggtctaaaaattgtaatggaaagtttgcattttgatttcttcttct |
43746964 |
T |
|
| Q |
318 |
tcttcctattcctacaaagctcattatgctccgaggaaggcttgtcattcggcgaactatcctatg |
383 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43746963 |
tcttcctattcctacaaagctcattatgctccgaggaaggcttgtcattcggcgaactatcctatg |
43746898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University