View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16688_low_49 (Length: 307)
Name: NF16688_low_49
Description: NF16688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16688_low_49 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 11 - 259
Target Start/End: Complemental strand, 8158111 - 8157861
Alignment:
| Q |
11 |
aaaacatgcaacttcactccaattaacgttgtgattgctttattagatgaaggtaaaataaaataagaaaaaatcatttttgtcccggcaagttttcttt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8158111 |
aaaacatgcaacttcactccaattaacgttgtgattgctttattagatgaaggtaaaataaaataagaaaaaatcatttttgtcccggcaagttttcttt |
8158012 |
T |
|
| Q |
111 |
acagtttctcccacccagcaaataaaataatactactttagtctagcaaaattctaatgtgtttatataatttaatatctttattgaagtgttaatttct |
210 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8158011 |
acagtttctcccacctagcaaataaaataatactactttagtctagcaaaattctaatgtgtttatatattttaatatctttattgaagtgttaatttct |
8157912 |
T |
|
| Q |
211 |
tctcccaacac--ttctctcgttttatgtaagaattaaacattaagctact |
259 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8157911 |
tctcccaacacaattctctcgttttatgtaagaattaaacattaagctact |
8157861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University