View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16688_low_50 (Length: 303)
Name: NF16688_low_50
Description: NF16688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16688_low_50 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 10 - 288
Target Start/End: Original strand, 7831658 - 7831940
Alignment:
| Q |
10 |
gcaaaggacattttcttttccatctgtcaagatataaggctcaaaactatcaacaaaagaagtgagactagcaaaatcactctgcttgcaaaccatcatg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7831658 |
gcaaaggacattttcttttccatctgtcaagatataaggctcaaaactatcaacaaaagaagtgagactagcaaaatcactctgcttgcaaaccatcatg |
7831757 |
T |
 |
| Q |
110 |
cgatcatacaaacaaatgaacatcttttctctcatgttaaaatggtccgcaattatgtaaagagaaaattggggcactttctcgttaacgggagccctaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| ||||| |||||||||||||||||| |||||||||| |
|
|
| T |
7831758 |
cgatcatacaaacaaatgaacatcttttctcttatgttaaaatggtcctcaattatgtaaagaggaaatttgggcactttctcgttaacaggagccctaa |
7831857 |
T |
 |
| Q |
210 |
cattattagtagcaacaacacctacttggtcctaaatggccctcgtctccat----aaaaaatgaattctttgtggccatctt |
288 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
7831858 |
cattattagtagtaacaacacctacttggtcctaaatggccctcgtctctatataaaaaaaatgaattctttgtggccatctt |
7831940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University