View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16688_low_62 (Length: 271)
Name: NF16688_low_62
Description: NF16688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16688_low_62 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 17 - 271
Target Start/End: Complemental strand, 28526426 - 28526172
Alignment:
| Q |
17 |
aatattacttttctcttatctactattaaaatattttaacctaacatggtgacaaaatggcacttacttaggaggcaaaacaaggatttgcttaatacat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28526426 |
aatattacttttctcttatctactattaaaatattttaacctaacattgtgacaaaatggcacttaattaggaggcaaaacaaggatttgcttaatacat |
28526327 |
T |
|
| Q |
117 |
ataaattttggtaatggcaaaaacttttggttagttcacgatgtaacaaaagtgcatgataagctgtctttctttgctcttattttgaccgaatcatatg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28526326 |
ataaattttggtaatggcaaaaacttttggttagttcacgatgtaacaaaagtgcatgataagctgtctttctttgctcttattttgaccgaatcatatg |
28526227 |
T |
|
| Q |
217 |
aattgatatctgatttgatacctaattccttgtgtttcatcaagccctcttactc |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28526226 |
aattgatatctgatttgatacctaattccttgtgtttcatcaagccctcttactc |
28526172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University