View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16688_low_64 (Length: 259)
Name: NF16688_low_64
Description: NF16688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16688_low_64 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 17 - 231
Target Start/End: Original strand, 21132404 - 21132620
Alignment:
| Q |
17 |
actatggaccatacaatgattagtggtggaatatagagtgaacactacctcatccaccatgtcaataacatatgtattgtctatctataggtgttgaaga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21132404 |
actatggaccatacaatgattagtggtggaatatagagtgaacactacctcatccaccatgtcaataacatatgtattgtctatctataggtgttgaaga |
21132503 |
T |
 |
| Q |
117 |
tttctactccaaaga--ctaaaataatctagaatactctaaaatttgcatcaattatcatttctctatgcaagacggcatataaatattgtataatttgc |
214 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21132504 |
tttctactccaaagactctaaaataatctagaatactctaaaatttgcatcaattatcatttctctatgcaagacggcatataaatattgtataatttgc |
21132603 |
T |
 |
| Q |
215 |
atgaattttaacattac |
231 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
21132604 |
atgaattttaacattac |
21132620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 208 - 247
Target Start/End: Original strand, 18661702 - 18661741
Alignment:
| Q |
208 |
aatttgcatgaattttaacattacgtaccattcacaggtt |
247 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
18661702 |
aatttgcatgaattttaacattacgtaccgtttacaggtt |
18661741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University