View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16688_low_70 (Length: 252)
Name: NF16688_low_70
Description: NF16688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16688_low_70 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 11 - 250
Target Start/End: Original strand, 28525733 - 28525972
Alignment:
| Q |
11 |
agcagagaggtggagttagaaaagagaaggaaagtaaaatgaaggagagtattttgtcccattaatcttttgtgctagggggcaactgaaatcagcgttc |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
28525733 |
agcacagaggtggagttagaaaagagaaggaaagtaaaatgaaggagagtattttgtcctattaatcttttgtgctaggggacgactgaaatcagcgttc |
28525832 |
T |
|
| Q |
111 |
tcaaccatttatgaaaattaaacaatttaaatttctaattttggatttgtcgagtcacattgtaagtcatctaatctctatcaacggacttaacttgctt |
210 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |||||||||||| | |
|
|
| T |
28525833 |
tcgaccatttatgaaaattaaacaatttaaatttctaattttgaatttgtcgagtcacattgtgagtcatctaatctctatcaactgacttaacttgcct |
28525932 |
T |
|
| Q |
211 |
aattgtagcgacttcaagagttattgactacaatgaatct |
250 |
Q |
| |
|
||||||||||||||||||||||||||| | |||| ||||| |
|
|
| T |
28525933 |
aattgtagcgacttcaagagttattgatttcaatcaatct |
28525972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University